Assessment of Genetic and Pathogenic Variation among Ascochyta rabiei
 
Prakriti Rohini Pratijit, Grade 7, École Lakeview School, Saskatoon
Background Objectives Materials & Methods Results Conclusions References Acknowledgements Project Information
Materials & Methods

Pathogenecity Study

Pathogenicity of all 10 isolates has been evaluated on the susceptible chickpea cultivar CDC Chico. There were four replicate of each isolate. A water-inoculated pot was included as a control. A rating scale 1-9 was adapted from Chongo et al. (2004). First disease rating was done ten days after inoculation followed by two more rating consecutively after a week's interval.

SSR Molecular Marker Study

For DNA extraction, all ten isolates were grown at room temperature in Glucose Yeast Liquid (GYL) medium. DNA was extracted using Raeder and Broda's (1985) minipreparation method. Using five SSR primers, amplification reaction was performed in polymerase chain reaction (PCR) machine. PCR was done in 25 µl volumes containing 50 mM MgCl2, 10 mM dNTP mix containing all four of the dNTPs (0.2 mM dCTP; 0.2 mM dGTP; 0.2 mM dTTP; and, 0.2 mM dATP) at a final concentration of 10 mM. The 10X Taq buffer contains 500 mM KCl, 100 mM Tris HCl, 15 mM MgCl2, 1% Triton X-100 buffer, 5 pM of each primer, 0.5 units Taq DNA polymerase and 30 ng of DNA. After initial denaturation at 96°C for 2 min, PCR was run for 35 cycles (denaturing of DNA at 96°C for 15 seconds, annealing of primers at 61°C for 30 seconds, extending of primer at 72°C for 45 seconds) in a gradient cycler. SSR primers presented in Table 1 were used for SSR molecular marker analysis. The SSR data were assessed for the presence of polymorphic bands on each DNA sample using Polyacrylamide gel electrophoresis. Absence and presence of bands were scored, and data were analyzed by cluster analysis using DICE’s genetic similarity coefficient with the help of NTSYS software.
 

Table 1. Five SSR primers used for SSR marker analysis
LocusRepeats of Cloned AllelePrimer sequence(5'-3')Expected size (bp)
ArA02TGAA(N)9(GAA)8GATCACATGCAACTAGGGTATC
ATGCAGACGTAGAAGTCCATAC
152
ArA06T(CAACAC)7(N)9(CAC)3CTCGAAACACATTCCTGTGC
GGTAGAAACGACGAATAGGG
162
ArH05T(CTT)18CATTGTGGCATCTGACATCAC
TGGATGGGAGGTTTTTGGTA
197
ArR12D(CA)15ATACACCCAAACCGGGTATC
GTATGGAATGTGCGATAGGA
158
ArH07D(GT)23GAGATCCGTGTGAAGCATGA
CCATGTGGACAGATTACATTCC
184

 

Background  |   Objectives  |   Materials & Methods  |   Results  |   Conclusions  |   References  |   Acknowledgements  |   Project Information

© Prakriti Rohini Pratijit. All rights reserved.